Connect.BarcodeofLife.net

international online community for dna barcoding professionals

s.vinoth kumar
  • Male
  • trichy,tamil nadu
  • India
Share on Facebook Share Twitter

S.vinoth kumar's Colleagues

  • Tamara Gurevich
  • Appala Naidu
  • Nicolas HUBERT
  • k.sathis kumar
  • Prasanna Kumar
  • Vinod Devidas Devarkar
  • VIJEESHNARAYANAN
  • Ravi Kumar Saini
  • Isaac Chow
  • Didier Zoccola
  • Snehal Bagatharia
  • Dr. TRIBHUWAN CHANDRA
  • karan veer singh
  • Dhivya
  • George K Mugambi

s.vinoth kumar's Groups

s.vinoth kumar's Discussions

Primer detail
3 Replies

Can any help with what primer to use for the Marine fish DNA sequencing in world wide. Any other specific primers are there for reef associated fish DNA sequencing.

Started this discussion. Last reply by s.vinoth kumar May 10, 2011.

Isolation of Mitochondria

If any possibilities there to extract the total mitochondria from the fish skin tisssues??Continue

Started Jul 8, 2012

Data Analysis

 If any software or online programs about the analysis of Barcode data. Specifically after sequencing how to generate the Barocde data using bioinformatics tools??  Any online programs is available?Continue

Started Nov 25, 2011

Introduction

Hai, i'm vinoth from bharathidasan university, tirchy, India. i'm doing Pf.D. in ornamental fishes DNA barcoding. It is starting stage. so, i need some basic protocols about dna extraction and sequencing.

Started Jan 23, 2011

 

s.vinoth kumar's Page

Latest Activity

s.vinoth kumar joined Dr.C.VADIVALAGAN's group
Apr 7, 2013
Tamara Gurevich and s.vinoth kumar are now colleagues
Nov 9, 2012
s.vinoth kumar posted a discussion

Isolation of Mitochondria

If any possibilities there to extract the total mitochondria from the fish skin tisssues??See More
Jul 8, 2012
s.vinoth kumar joined Prasanna Kumar's group
Thumbnail

Barcoding Bacteria

To discuss issues pertaining DNA barcoding bacteriaSee More
Dec 14, 2011
s.vinoth kumar posted a discussion

Data Analysis

 If any software or online programs about the analysis of Barcode data. Specifically after sequencing how to generate the Barocde data using bioinformatics tools??  Any online programs is available?See More
Nov 25, 2011
s.vinoth kumar joined Megan A. Milton's group
Thumbnail

BOLD Systems

The Barcode of Life Data Systems (BOLD) is an online workbench that aids collection, management, analysis, and use of DNA barcodes. See More
Nov 13, 2011
s.vinoth kumar joined Kris Jett's group
Thumbnail

Lab Operations

Come share protocols and troubleshooting experiences, compare techniques, and discuss collaborative efforts.
Nov 13, 2011
s.vinoth kumar and Appala Naidu are now colleagues
Oct 4, 2011
s.vinoth kumar joined Kris Jett's group
Thumbnail

CBOL Leading Labs Network (LLN)

The CBOL Leading Labs Network (LLN) was created in 2007 as a network of barcoding labs around the world dedicated to sharing technical information on barcoding and providing training and resources for new barcoding researchers and labs.
Jun 22, 2011
Daniel Carvalho replied to s.vinoth kumar's discussion 'Primer detail'
"Try those from Ward et al 2005. They are pretty good!   FishF1-50TCAACCAACCACAAAGACATTGGCAC30, FishF2-5 0 TCGACTAATCATAAAGATATCGGCAC3 0 , FishR1-50 TAGACTTCTGGGTGGCCAAAGAATCA30 , FishR2-5 0 ACTTCAGGGTGACCGAAGAATCAGAA3 0 .  "
May 10, 2011
Abhishek Kr. Malakar replied to s.vinoth kumar's discussion 'Primer detail'
"Hi, Universal primer are used for Marine Fish DNA Barcoding.   Primers FishF1 & FishF2 (Forward) FishR1 & Fish R2 (Reverse)"
May 10, 2011
s.vinoth kumar posted a discussion

Primer detail

Can any help with what primer to use for the Marine fish DNA sequencing in world wide. Any other specific primers are there for reef associated fish DNA sequencing.
May 9, 2011
s.vinoth kumar and Vinod Devidas Devarkar are now colleagues
May 5, 2011
s.vinoth kumar joined Manimekalan's group
Jan 26, 2011
s.vinoth kumar joined Dirk Steinke's group
Jan 26, 2011
s.vinoth kumar joined Mehrdad Hajibabaei's group
Jul 20, 2010
s.vinoth kumar and Kris Jett are now colleagues
Jun 12, 2010
s.vinoth kumar joined Robert Hanner's group
Thumbnail

FISH-BOL

Fish Barcode of Life Campaign
May 26, 2010
s.vinoth kumar is now a member of Connect.BarcodeofLife.net
May 24, 2010

Profile Information

Institution/Organization
Bharathidasan University, Trichirappalli,TamilNadu, India
Title/Position
Doctoral student
If Other Title, please specify
Working in Marine ornamental fish DNA barcoding identification
I’m involved in, or am interested in the following barcoding initiatives
FISH-BOL, Data Analysis Working Group
I’m involved in or interested in the following iBOL Working Groups
WG2.3 Methodological Innovation
I’m involved in the following aspects of barcoding:
Fieldwork/specimen collecting, Labwork/generating barcode sequences, Using barcode data in taxonomy/systematic biology
Current Project(s)
Doing Ph.D in Marine Science.

S.vinoth kumar's Blog

fish DNA barcoding

vinoth

Posted on May 26, 2010 at 6:38am — 1 Comment

My Comment Wall

You need to be a member of Connect.BarcodeofLife.net to add comments!

Join Connect.BarcodeofLife.net

  • No comments yet!
 
 
 

Translate

Tory's site-wide code

New to the Connect network?


Watch our Intro Webinar


Introduce yourself to the Connect community


Write a blog post


Ask a question

Tory's code

© 2014   Created by Mike Trizna.   Powered by

Badges  |  Report an Issue  |  Terms of Service