Barcoding Bacteria
To discuss issues pertaining DNA barcoding bacteriaSee More
international online community for dna barcoding professionals
-
s.vinoth kumar
- Male
- trichy,tamil nadu
- India
- Blog Posts (1)
- Discussions (3)
- Events
- Groups (8)
- Photos
- Photo Albums
- Videos
s.vinoth kumar's Groups
-
Barcoding Bacteria
6 members
-
BOLD Systems
79 members
-
Lab Operations
59 members
-
CBOL Leading Labs Networ…
40 members
-
Freshwater Fish Taxonomi…
5 members
s.vinoth kumar's Discussions
Primer detail
3 Replies
Can any help with what primer to use for the Marine fish DNA sequencing in world wide. Any other specific primers are there for reef associated fish DNA sequencing.
Started this discussion. Last reply by s.vinoth kumar May 10, 2011.
Data Analysis
If any software or online programs about the analysis of Barcode data. Specifically after sequencing how to generate the Barocde data using bioinformatics tools?? Any online programs is available?Continue
Started Nov 25, 2011
Introduction
Hai, i'm vinoth from bharathidasan university, tirchy, India. i'm doing Pf.D. in ornamental fishes DNA barcoding. It is starting stage. so, i need some basic protocols about dna extraction and sequencing.
Started Jan 23, 2011
s.vinoth kumar's Page
Latest Activity
Data Analysis
If any software or online programs about the analysis of Barcode data. Specifically after sequencing how to generate the Barocde data using bioinformatics tools?? Any online programs is available?See More
Discussion posted by s.vinoth kumar
BOLD Systems
The Barcode of Life Data Systems (BOLD) is an online workbench that aids collection, management, analysis, and use of DNA barcodes. See More
s.vinoth kumar joined Megan A. Milton's group
Lab Operations
Come share protocols and troubleshooting experiences, compare techniques, and discuss collaborative efforts.
s.vinoth kumar joined Kris Jett's group
CBOL Leading Labs Network (LLN)
The CBOL Leading Labs Network (LLN) was created in 2007 as a network of barcoding labs around the world dedicated to sharing technical information on barcoding and providing training and resources for new barcoding researchers and labs.
s.vinoth kumar joined Kris Jett's group
Daniel Carvalho replied to s.vinoth kumar's discussion 'Primer detail'
Try those from Ward et al 2005. They are pretty good!
FishF1-50TCAACCAACCACAAAGACATTGGCAC30,
FishF2-5 0 TCGACTAATCATAAAGATATCGGCAC3 0 ,
FishR1-50 TAGACTTCTGGGTGGCCAAAGAATCA30 ,
FishR2-5 0 ACTTCAGGGTGACCGAAGAATCAGAA3 0 .
Abhishek Kr. Malakar replied to s.vinoth kumar's discussion 'Primer detail'
Hi,
Universal primer are used for Marine Fish DNA Barcoding.
Primers
FishF1 & FishF2 (Forward)
FishR1 & Fish R2 (Reverse)
Primer detail
Can any help with what primer to use for the Marine fish DNA sequencing in world wide. Any other specific primers are there for reef associated fish DNA sequencing.
Discussion posted by s.vinoth kumar
Profile Information
- Institution/Organization
- Bharathidasan University, Trichirappalli,TamilNadu, India
- Title/Position
- Doctoral student
- If Other Title, please specify
- Working in Marine ornamental fish DNA barcoding identification
- I’m involved in, or am interested in the following barcoding initiatives
- FISH-BOL, Data Analysis Working Group
- I’m involved in or interested in the following iBOL Working Groups
- WG2.3 Methodological Innovation
- I’m involved in the following aspects of barcoding:
- Fieldwork/specimen collecting, Labwork/generating barcode sequences, Using barcode data in taxonomy/systematic biology
- Current Project(s)
- Doing Ph.D in Marine Science.
S.vinoth kumar's Blog
© 2012 Created by Matthew Fisher.
Powered by 
.
