Connect.BarcodeofLife.net

international online community for dna barcoding professionals

Keith Seifert's Colleagues

  • BD Shenoy
  • Conrad Schoch
  • Mike Trizna

Keith Seifert's Groups

 

Keith Seifert's Page

Latest Activity

Keith Seifert replied to Conrad Schoch's discussion 'Definition of an acceptable Fungal ITS barcode' in the group Fungi
"Hi everyone, There are a lot of issues brought up by different people in the discussion, so thanks for that. What will happen at BOLD is that they will create an informatics pipeline that checks sequences submitted as ITS sequences to be sure that…"
Feb 15, 2012
Mike Trizna left a comment for Keith Seifert
"Keith, sorry to hear the poster upload didn't work. You're welcome to just e-mail the poster to cbol@si.edu and we'll upload it and link to it ourselves. Thanks for trying!"
Nov 18, 2011
Bryn T. M. Dentinger replied to Keith Seifert's discussion 'Defining the boundaries of the ITS barcode' in the group Fungi
"right, thanks for pointing out my taxonomic bias! looks like there is no universally constant region within the 28S that could serve as a handle without needing exceptions. but rather than trimming sequences to within these motifs, what would be…"
May 18, 2011
Henrik Nilsson replied to Keith Seifert's discussion 'Defining the boundaries of the ITS barcode' in the group Fungi
"Well in fact only one is non-fungal: >00062Mts_mtsctlts__Motse_J01871__X00525 (Mus musculus)"
May 18, 2011
Henrik Nilsson replied to Keith Seifert's discussion 'Defining the boundaries of the ITS barcode' in the group Fungi
">Keith said: >It will be helpful to establish a standard for ITS barcodes, and the proposal >that I put on the table is that it be between these two motifs.   This sounds good to me. What about adding an additional requirement: that…"
May 18, 2011
Bryn T. M. Dentinger replied to Keith Seifert's discussion 'Defining the boundaries of the ITS barcode' in the group Fungi
"we have been routinely trimming our ITS sequences to beginning and ending with the CATTA- and -GACCT motifs. The -GACCT motif can vary a bit depending on which groups you work in (highly variable in Hygrocybe, for instance), but in my experience…"
May 17, 2011
Andrew Miller replied to Keith Seifert's discussion 'Defining the boundaries of the ITS barcode' in the group Fungi
"Good thoughts Keith.   My lab edits all ITS sequences to include the 5' and 3' primers.  In most cases, this is ITS1F and ITS4 and would include your two proposed motifs above so I'm good with this.   If I'm not…"
May 17, 2011
Keith Seifert added a discussion to the group Fungi
Thumbnail

Defining the boundaries of the ITS barcode

Many people truncate their ITS sequences to begin with the last bases of the 18S, which facilitates alignment with some algorithms: CATTA The 28S begins with this set of bases in Saccharomyces, fairly conserved: GTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA It will be helpful to establish a standard for ITS barcodes, and the proposal that I put on the table is that it be between these two motifs. All of the ITS barcodes that are included in the data release for our paper should…See More
May 17, 2011
Keith Seifert replied to Conrad Schoch's discussion 'Additional primers?' in the group Fungi
"At this stage, for data comparision, standardization of primers is probably not critical. But remember that standardization is a big deal in the barcoding world (practically the point of the whole thing actually), and in the end we will provide more…"
Oct 26, 2010
Keith Seifert and BD Shenoy are now colleagues
Oct 1, 2010
Keith Seifert posted a photo
Sep 30, 2010
Keith Seifert joined Conrad Schoch's group
Thumbnail

Fungi

To provide up-to-date information on fungal barcoding and to facilitate communication and the development of collaboration.
Sep 30, 2010
Keith Seifert updated their profile photo
Dec 1, 2009
Keith Seifert is now a member of Connect.BarcodeofLife.net
Dec 1, 2009

Profile Information

Institution/Organization
Agriculture & Agri-Food Canada
Title/Position
Researcher/Faculty member
I’m involved in or interested in the following iBOL Working Groups
WG1.3 Fungi
Keywords about my barcoding projects (separate each choice with a comma)
fungi, moulds, indoor mycota
I’m involved in the following aspects of barcoding:
Fieldwork/specimen collecting, Museum work/specimen curation, Labwork/generating barcode sequences, Management of barcode data, Analysis of barcode data, Using barcode data in taxonomy/systematic biology, Organizing/managing barcoding projects, Science policy related to barcoding
Current Project(s)
IM-BOL, Indoor Mycota Barcode of Life

my picture

I look happy in this picture because I am patting a koala!

Keith Seifert's Photos

Loading…
  • Add Photos
  • View All

Comment Wall (2 comments)

You need to be a member of Connect.BarcodeofLife.net to add comments!

Join Connect.BarcodeofLife.net

At 1:28pm on November 18, 2011, Mike Trizna said…

Keith, sorry to hear the poster upload didn't work. You're welcome to just e-mail the poster to cbol@si.edu and we'll upload it and link to it ourselves.

Thanks for trying!

At 12:56pm on December 2, 2009, Kris Jett said…
Hello and welcome!

Thank you for taking the time to join. Here are a few things that you can do in the community.

After completing your online profile, please add yourself to the member map.
Next, invite your colleagues and search our members for people you know and invite them to be your colleague in the network.
Or browse our Forum and ask a question.
Please join a Group or start your own, as groups are a great way to express your special interest, be it a taxonomic group, a regional or organizational affiliation.
Have a question? Ask one of our hosts.


A few more...
Please contribute to our Blog. Simply choose “Add a Blog Post” under Blogs.
If you already have a blog, you can share it through RSS either on your page or on our rss pages. Just ask me how.
Or create a group and invite colleagues to join. Use “Send Message to Group” to email everyone in your group, start discussions specific to your group’s interests, add widgets and more.

For assistance, don’t hesitate to contact me.

Again, thank you for joining our growing online community. I look forward to connecting with you soon.

-Kris Jett
 
 
 

Translate

Tory's site-wide code

New to the Connect network?


Watch our Intro Webinar


Introduce yourself to the Connect community


Write a blog post


Ask a question

Tory's code

© 2014   Created by Mike Trizna.   Powered by

Badges  |  Report an Issue  |  Terms of Service