Connect.BarcodeofLife.net

international online community for dna barcoding professionals

Keith Seifert
Keith Seifert
Share on Facebook Share Twitter

Keith Seifert's Colleagues

  • BD Shenoy
  • Conrad Schoch
  • John Chenery
  • Mike Trizna

Keith Seifert's Groups

 

Keith Seifert's Page

Latest Activity

Profile Icon
Mike Trizna left a comment for Keith Seifert
Keith, sorry to hear the poster upload didn't work. You're welcome to just e-mail the poster to cbol@si.edu and we'll upload it and link to it ourselves. Thanks for trying!
Nov 18, 2011
Profile Icon
Bryn T. M. Dentinger replied to Keith Seifert's discussion 'Defining the boundaries of the ITS barcode' in the group Fungi
right, thanks for pointing out my taxonomic bias! looks like there is no universally constant region within the 28S that could serve as a handle without needing exceptions. but rather than trimming sequences to within these motifs, what would be…
May 18, 2011
Profile Icon
Henrik Nilsson replied to Keith Seifert's discussion 'Defining the boundaries of the ITS barcode' in the group Fungi
Well in fact only one is non-fungal: >00062Mts_mtsctlts__Motse_J01871__X00525 (Mus musculus)
May 18, 2011
Profile Icon
Henrik Nilsson replied to Keith Seifert's discussion 'Defining the boundaries of the ITS barcode' in the group Fungi
>Keith said: >It will be helpful to establish a standard for ITS barcodes, and the proposal >that I put on the table is that it be between these two motifs.   This sounds good to me. What about adding an additional requirement: that…
May 18, 2011
Profile Icon
Bryn T. M. Dentinger replied to Keith Seifert's discussion 'Defining the boundaries of the ITS barcode' in the group Fungi
we have been routinely trimming our ITS sequences to beginning and ending with the CATTA- and -GACCT motifs. The -GACCT motif can vary a bit depending on which groups you work in (highly variable in Hygrocybe, for instance), but in my experience…
May 17, 2011
Profile Icon
Andrew Miller replied to Keith Seifert's discussion 'Defining the boundaries of the ITS barcode' in the group Fungi
Good thoughts Keith.   My lab edits all ITS sequences to include the 5' and 3' primers.  In most cases, this is ITS1F and ITS4 and would include your two proposed motifs above so I'm good with this.   If I'm not…
May 17, 2011
Profile Icon

Defining the boundaries of the ITS barcode

Thumbnail
Many people truncate their ITS sequences to begin with the last bases of the 18S, which facilitates alignment with some algorithms: CATTA The 28S begins with this set of bases in Saccharomyces, fairly conserved: GTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA It will be helpful to establish a standard for ITS barcodes, and the proposal that I put on the table is that it be between these two motifs. All of the ITS barcodes that are included in the data release for our paper should…See More
Keith Seifert added a discussion to the group Fungi May 17, 2011
5 Comments
Profile Icon
Keith Seifert replied to Conrad Schoch's discussion 'Additional primers?' in the group Fungi
At this stage, for data comparision, standardization of primers is probably not critical. But remember that standardization is a big deal in the barcoding world (practically the point of the whole thing actually), and in the end we will provide more…
Oct 26, 2010
Profile IconProfile Icon
Keith Seifert and BD Shenoy are now colleagues Oct 1, 2010
Profile Icon

seifert

Thumbnail
Photo posted by Keith Seifert Sep 30, 2010
0 Comments
Profile Icon

Fungi

Thumbnail
To provide up-to-date information on fungal barcoding and to facilitate communication and the development of collaboration.
Keith Seifert joined Conrad Schoch's group Sep 30, 2010
3 Comments
Profile Icon
Keith Seifert updated their profile photo Dec 1, 2009
Profile Icon

iBOL Scientific Steering Committee

Thumbnail
The iBOL Scientific Steering Committee oversees the project's research activities. It includes representatives from all participating countries and from the 26 Working Groups.See More
Keith Seifert joined John Chenery's group Dec 1, 2009
Profile Icon
Keith Seifert is now a member of Connect.BarcodeofLife.net Dec 1, 2009
Welcome Them!

Profile Information

Institution/Organization
Agriculture & Agri-Food Canada
Title/Position
Researcher/Faculty member
I’m involved in or interested in the following iBOL Working Groups
WG1.3 Fungi
Keywords about my barcoding projects (separate each choice with a comma)
fungi, moulds, indoor mycota
I’m involved in the following aspects of barcoding:
Fieldwork/specimen collecting, Museum work/specimen curation, Labwork/generating barcode sequences, Management of barcode data, Analysis of barcode data, Using barcode data in taxonomy/systematic biology, Organizing/managing barcoding projects, Science policy related to barcoding
Current Project(s)
IM-BOL, Indoor Mycota Barcode of Life

my picture

I look happy in this picture because I am patting a koala!

Keith Seifert's Photos

Loading…
  • Add Photos
  • View All

Comment Wall (2 comments)

You need to be a member of Connect.BarcodeofLife.net to add comments!

Join Connect.BarcodeofLife.net

At 1:28pm on November 18, 2011, Mike TriznaMike Trizna said…

Keith, sorry to hear the poster upload didn't work. You're welcome to just e-mail the poster to cbol@si.edu and we'll upload it and link to it ourselves.

Thanks for trying!

At 12:56pm on December 2, 2009, Kris JettKris Jett said…
Hello and welcome!

Thank you for taking the time to join. Here are a few things that you can do in the community.

After completing your online profile, please add yourself to the member map.
Next, invite your colleagues and search our members for people you know and invite them to be your colleague in the network.
Or browse our Forum and ask a question.
Please join a Group or start your own, as groups are a great way to express your special interest, be it a taxonomic group, a regional or organizational affiliation.
Have a question? Ask one of our hosts.


A few more...
Please contribute to our Blog. Simply choose “Add a Blog Post” under Blogs.
If you already have a blog, you can share it through RSS either on your page or on our rss pages. Just ask me how.
Or create a group and invite colleagues to join. Use “Send Message to Group” to email everyone in your group, start discussions specific to your group’s interests, add widgets and more.

For assistance, don’t hesitate to contact me.

Again, thank you for joining our growing online community. I look forward to connecting with you soon.

-Kris Jett
 
 
 

Translate

Tory's site-wide code

New to the Connect network?


Watch our Intro Webinar

Introduce yourself to the Connect community

Write a blog post

Ask a question

Tory's code

© 2012   Created by Matthew Fisher.   Powered by .

Badges  |  Report an Issue  |  Terms of Service