Connect.BarcodeofLife.net

international online community for dna barcoding professionals

Daniel Carvalho
  • Male
  • Adelaide
  • Australia
Share on Facebook Share Twitter

Daniel Carvalho's Colleagues

  • Bineesh kinattumkara
  • s.vinoth kumar
  • Andrew Lowe
  • Luis Anderson Ribeiro Leite
  • Rick Turner
  • Natalia Ivanova
  • Fabricio R Santos
  • Alex Borisenko
  • Elizabeth A. Martínez-Salazar
  • Tara Dawne Gariepy
  • David Porco
  • Rodolphe Rougerie
  • Mariana L. Lyra
  • Dirk Steinke
  • Julie Stahlhut

Daniel Carvalho's Groups

 

Daniel Carvalho's Page

Latest Activity

Daniel Carvalho joined Mike Trizna's group
Thumbnail

CBOL Data Analysis Working Group (DAWG)

A place for CBOL DAWG members to interact.
Aug 24, 2011
Daniel Carvalho and s.vinoth kumar are now colleagues
Aug 24, 2011
Benjamin Victor left a comment for Daniel Carvalho
"I was reviewing my old exchanges, and I noticed your comment. Have you sequenced any gobies or blennies in the lower parts of your river?"
Jul 1, 2011
Mariana L. Lyra and Daniel Carvalho are now colleagues
Jun 20, 2011
Daniel Carvalho replied to s.vinoth kumar's discussion 'Primer detail'
"Try those from Ward et al 2005. They are pretty good!   FishF1-50TCAACCAACCACAAAGACATTGGCAC30, FishF2-5 0 TCGACTAATCATAAAGATATCGGCAC3 0 , FishR1-50 TAGACTTCTGGGTGGCCAAAGAATCA30 , FishR2-5 0 ACTTCAGGGTGACCGAAGAATCAGAA3 0 .  "
May 10, 2011
Daniel Carvalho and Julie Stahlhut are now colleagues
Feb 24, 2011
Daniel Carvalho and Bineesh kinattumkara are now colleagues
Oct 22, 2010
Daniel Carvalho and Kris Jett are now colleagues
Jun 14, 2010
Daniel Carvalho joined Robert Hanner's group
Thumbnail

FISH-BOL

Fish Barcode of Life Campaign
May 28, 2010
Daniel Carvalho and Luis Anderson Ribeiro Leite are now colleagues
Mar 1, 2010
Daniel Carvalho updated their profile
Feb 13, 2010
Daniel Carvalho updated their profile photo
Feb 13, 2010
Daniel Carvalho is now a member of Connect.BarcodeofLife.net
Feb 13, 2010

Profile Information

Institution/Organization
Flinders Uni
Title/Position
Postdoctoral fellow
I’m involved in, or am interested in the following barcoding initiatives
FISH-BOL
I’m involved in or interested in the following iBOL Working Groups
WG1.1 Vertebrates
Keywords about my barcoding projects (separate each choice with a comma)
Brazilian fshes
I’m involved in the following aspects of barcoding:
Fieldwork/specimen collecting, Labwork/generating barcode sequences, Management of barcode data, Analysis of barcode data, Using barcode data in taxonomy/systematic biology, Using barcode data for other applications

Comment Wall (4 comments)

You need to be a member of Connect.BarcodeofLife.net to add comments!

Join Connect.BarcodeofLife.net

At 3:09pm on July 1, 2011, Benjamin Victor said…
I was reviewing my old exchanges, and I noticed your comment. Have you sequenced any gobies or blennies in the lower parts of your river?
At 6:52pm on June 19, 2010, Benjamin Victor said…
Daniel- your Brazilian fish project- Marine or Freshwater?
At 9:47am on May 28, 2010, Rick Turner said…
Hey Daniel Hope all is well.

Are you settling in OK?

The warm weather just started here for us.
Anderson thinks it too hot and is happy to return home tomorrow.

Cheers,


Rick
At 8:03am on February 24, 2010, Kris Jett said…
Hello and welcome!

Thank you for taking the time to join. Here are a few things that you can do in the community.

After completing your online profile, please add yourself to the member map. Next, invite your colleagues and search our members for people you know and invite them to be your colleague in the network. Or browse our Forum and ask a question.

Please join a Group or start your own, as groups are a great way to express your special interest, be it a taxonomic group, a regional or organizational affiliation. Have a question? Ask one of our hosts.


A few more...
Please contribute to our Blog. Simply choose “Add a Blog Post” under Blogs. If you already have a blog, you can share it through RSS either on your page or on our rss pages. Just ask me how.
Or create a group and invite colleagues to join. Use “Send Message to Group” to email everyone in your group, start discussions specific to your group’s interests, add widgets and more.

For assistance, don’t hesitate to contact me.

Again, thank you for joining our growing online community. I look forward to connecting with you soon.

-Kristin Jett
 
 
 

Translate

Tory's site-wide code

New to the Connect network?


Watch our Intro Webinar


Introduce yourself to the Connect community


Write a blog post


Ask a question

Tory's code

© 2013   Created by Matthew Fisher.   Powered by

Badges  |  Report an Issue  |  Terms of Service