international online community for dna barcoding professionals
-
Daniel Carvalho
- Male
- Adelaide
- Australia
- Blog Posts
- Discussions (1)
- Events
- Groups (2)
- Photos
- Photo Albums
- Videos
Daniel Carvalho's Page
Latest Activity
Benjamin Victor left a comment for Daniel Carvalho"I was reviewing my old exchanges, and I noticed your comment. Have you sequenced any gobies or blennies in the lower parts of your river?"
Daniel Carvalho replied to s.vinoth kumar's discussion 'Primer detail'"Try those from Ward et al 2005. They are pretty good!
FishF1-50TCAACCAACCACAAAGACATTGGCAC30,
FishF2-5 0 TCGACTAATCATAAAGATATCGGCAC3 0 ,
FishR1-50 TAGACTTCTGGGTGGCCAAAGAATCA30 ,
FishR2-5 0 ACTTCAGGGTGACCGAAGAATCAGAA3 0 .
"
Profile Information
- Institution/Organization
- Flinders Uni
- Title/Position
- Postdoctoral fellow
- I’m involved in, or am interested in the following barcoding initiatives
- FISH-BOL
- I’m involved in or interested in the following iBOL Working Groups
- WG1.1 Vertebrates
- Keywords about my barcoding projects (separate each choice with a comma)
- Brazilian fshes
- I’m involved in the following aspects of barcoding:
- Fieldwork/specimen collecting, Labwork/generating barcode sequences, Management of barcode data, Analysis of barcode data, Using barcode data in taxonomy/systematic biology, Using barcode data for other applications
Comment Wall (4 comments)
- At 3:09pm on July 1, 2011, Benjamin Victor said…
- I was reviewing my old exchanges, and I noticed your comment. Have you sequenced any gobies or blennies in the lower parts of your river?
- At 6:52pm on June 19, 2010, Benjamin Victor said…
- Daniel- your Brazilian fish project- Marine or Freshwater?
- At 9:47am on May 28, 2010,
Rick Turner said… - Hey Daniel Hope all is well.
Are you settling in OK?
The warm weather just started here for us.
Anderson thinks it too hot and is happy to return home tomorrow.
Cheers,
Rick
- At 8:03am on February 24, 2010,
Kris Jett said… - Hello and welcome!
Thank you for taking the time to join. Here are a few things that you can do in the community.
After completing your online profile, please add yourself to the member map. Next, invite your colleagues and search our members for people you know and invite them to be your colleague in the network. Or browse our Forum and ask a question.
Please join a Group or start your own, as groups are a great way to express your special interest, be it a taxonomic group, a regional or organizational affiliation. Have a question? Ask one of our hosts.
A few more...
Please contribute to our Blog. Simply choose “Add a Blog Post” under Blogs. If you already have a blog, you can share it through RSS either on your page or on our rss pages. Just ask me how.
Or create a group and invite colleagues to join. Use “Send Message to Group” to email everyone in your group, start discussions specific to your group’s interests, add widgets and more.
For assistance, don’t hesitate to contact me.
Again, thank you for joining our growing online community. I look forward to connecting with you soon.
-Kristin Jett
© 2013 Created by Matthew Fisher.
Powered by
