Connect.BarcodeofLife.net

international online community for dna barcoding professionals

Hello sir/madam,

                     I am currently working on  DNA Barcoding of the odonata.Am in the initial stages of sample collection and only limited referece are available on this area of study.Already,literature is available on 16s and 28s mitochondrial genes,there is no data available on the CO1 gene.So please suggest me which gene is ideal for the species identification and if any specific primer is suitable for the data mentioned above kindly suggest me,do the needful.

Tags: CO1, gene, odonata, primer

Views: 139

Replies to This Discussion

have u got a specific primer for the species identification of insects ? am working presently on DNA Barcoding of insects, but i could not get amplification with a CO1 gene. if u have got a primer, can u suggest me a specific primer?

Hello Anna,

              Am working on DNA Barcoding of insects. But I used many primer based on the species.  Regarding your question, I have one doubt. If you have chosen insect group and how many group you focused and their order name is needed and after I can suggest  primer it will be useful for your study.

Thank you.     

hi vadivalagan,

now am working on diptera and hymenoptera! i could not get a specific primer for both of these orders...yet!

thank you

hello anna,

i think following link is helpfull for you.

Diptera

Gibson, J. F., S. Kelso, M. D. Jackson, J. H. Kits, G. F. G. Miranda, and J.H. Skevington. 2011. Diptera-specific PCR-amplification primers of use in molecular phylogenetic research. Annals of the Entomological Society of America 104: 976–997

Hymenoptera

LCO_Hym  COI-5P- TATCAACCAATCATAAAGATATTGG

thank you sir.

RSS

Translate

Tory's site-wide code

New to the Connect network?


Watch our Intro Webinar


Introduce yourself to the Connect community


Write a blog post


Ask a question

Tory's code

© 2013   Created by Matthew Fisher.   Powered by

Badges  |  Report an Issue  |  Terms of Service