primer

Replies to This Discussion

Permalink Reply by Anoja Kurian on January 3, 2012 at 2:18am

have u got a specific primer for the species identification of insects ? am working presently on DNA Barcoding of insects, but i could not get amplification with a CO1 gene. if u have got a primer, can u suggest me a specific primer?

Permalink Reply by C.Vadivalagan on January 3, 2012 at 3:32am

Hello Anna,

              Am working on DNA Barcoding of insects. But I used many primer based on the species.  Regarding your question, I have one doubt. If you have chosen insect group and how many group you focused and their order name is needed and after I can suggest  primer it will be useful for your study.

Thank you.     

Permalink Reply by Anoja Kurian on January 3, 2012 at 11:45pm

hi vadivalagan,

now am working on diptera and hymenoptera! i could not get a specific primer for both of these orders...yet!

thank you

Permalink Reply by C.Vadivalagan on January 5, 2012 at 8:00am

hello anna,

i think following link is helpfull for you.

Diptera

Gibson, J. F., S. Kelso, M. D. Jackson, J. H. Kits, G. F. G. Miranda, and J.H. Skevington. 2011. Diptera-specific PCR-amplification primers of use in molecular phylogenetic research. Annals of the Entomological Society of America 104: 976–997

Hymenoptera

LCO_Hym  COI-5P- TATCAACCAATCATAAAGATATTGG

Permalink Reply by Anoja Kurian on January 6, 2012 at 1:37am

thank you sir.