international online community for dna barcoding professionals
Hello sir/madam,
I am currently working on DNA Barcoding of the odonata.Am in the initial stages of sample collection and only limited referece are available on this area of study.Already,literature is available on 16s and 28s mitochondrial genes,there is no data available on the CO1 gene.So please suggest me which gene is ideal for the species identification and if any specific primer is suitable for the data mentioned above kindly suggest me,do the needful.
Tags: CO1, gene, odonata, primer
Permalink Reply by Anoja Kurian on January 3, 2012 at 2:18am have u got a specific primer for the species identification of insects ? am working presently on DNA Barcoding of insects, but i could not get amplification with a CO1 gene. if u have got a primer, can u suggest me a specific primer?
Permalink Reply by C.Vadivalagan on January 3, 2012 at 3:32am Hello Anna,
Am working on DNA Barcoding of insects. But I used many primer based on the species. Regarding your question, I have one doubt. If you have chosen insect group and how many group you focused and their order name is needed and after I can suggest primer it will be useful for your study.
Thank you.
Permalink Reply by Anoja Kurian on January 3, 2012 at 11:45pm hi vadivalagan,
now am working on diptera and hymenoptera! i could not get a specific primer for both of these orders...yet!
thank you
Permalink Reply by C.Vadivalagan on January 5, 2012 at 8:00am hello anna,
i think following link is helpfull for you.
Diptera
Gibson, J. F., S. Kelso, M. D. Jackson, J. H. Kits, G. F. G. Miranda, and J.H. Skevington. 2011. Diptera-specific PCR-amplification primers of use in molecular phylogenetic research. Annals of the Entomological Society of America 104: 976–997
Hymenoptera
LCO_Hym COI-5P- TATCAACCAATCATAAAGATATTGG
Permalink Reply by Anoja Kurian on January 6, 2012 at 1:37am thank you sir.
© 2012 Created by Matthew Fisher.
Powered by