international online community for dna barcoding professionals

Primer combinations for marine groups

This is a bulletin board for adding primers that are used in Marine Barcoding. Please add primer names, sequences and all relevant information you want to share in the reply field.

Replies to This Discussion

Permalink Reply by Dirk Steinke on May 27, 2011 at 2:22pm

Marker: COI

Taxonomic group: Crustaceans (universal)

Developed as alternative to the Folmer primer combination with a couple of degenerate sites

CrustDF1 GGTCWACAAAYCATAAAGAYATTGG (forward)

CrustDR1 TAAACYTCAGGRTGACCRAARAAYCA (reverse)

Permalink Reply by Dirk Steinke on May 27, 2011 at 2:26pm

Marker: COI

Taxonomic group: Polychaetes

Works with a variety of polychaete groups. Unfortunately not all of them :-(

polyLCO GAYTATWTTCAACAAATCATAAAGATATTGG (forward)

polyHCO TAMACTTCWGGGTGACCAAARAATCA (reverse)

Permalink Reply by Dirk Steinke on May 27, 2011 at 2:30pm

Marker: COI

Taxonomic group: Gastropods

Was designed for cowries but works for a variety of gastropods and a few bivalves.

dgLCO-1490 GGTCAACAAATCATAAAGAYATYGG (forward)

dgHCO-2198 TAAACTTCAGGGTGACCAAARAAYCA (reverse)

Permalink Reply by Lyndell M. Bade on February 14, 2012 at 2:18pm

Hi Dirk,

This is a really terrific discussion...thanks for hosting and adding to it! Have you done any bivalve work yourself? I'm just wondering if you found some primers that worked and others that didn't work as well...I'm starting the sequencing process tomorrow on my shellfish species. I'm starting with the LCO and HCO primers. I'd appreciate any ideas/referrals/suggestions you may have.

All the Best,

Lyndell

Permalink Reply by Dirk Steinke on May 27, 2011 at 2:34pm

Marker: COI

Taxonomic group: Tunicates

Works for a number of different ascidian families.

Tun_forward TCGACTAATCATAAAGATATTA (forward)

Tun_reverse2 AACTTGTATTTAAATTACGATC (reverse)

Permalink Reply by Xavier Turon on February 12, 2012 at 7:09am

Actually, there is a G to be added to the end of the forward primer. This nucleotide was cut off in Stefaniak's paper when her Table was trimmed. I confirmed this with Lauren Stefaniak.

Permalink Reply by Dirk Steinke on May 27, 2011 at 2:39pm

Marker: COI

Taxonomic group: universal

The classical Folmer primer

LCO1490 GGTCAACAAATCATAAAGATATTGG (forward)

HCO2198 TAAACTTCAGGGTGACCAAAAAATCA (reverse)

Permalink Reply by Dirk Steinke on May 27, 2011 at 3:02pm

Marker COI

Taxonomic group: Echinoderms

Several combinations listed here. We usually start with option (1) and move on to option (2). (3) works better with Holothurians but is a bit downstream of the standard barcoding region.

(1)

LCOech1aF1 TTTTTTCTACTAAACACAAGGATATTGG (forward - designed by Doug Eernisse - unpublished)

HCO2198 TAAACTTCAGGGTGACCAAAAAATCA (reverse - Folmer standard)

(2)

EchinoF1 TTTCAACTAATCATAAGGACATTGG (forward - Ward et al. 2008)

HCO2198 TAAACTTCAGGGTGACCAAAAAATCA (reverse - Folmer standard)

(3)

COIeF1 ATAATGATAGGAGGRTTTGG (forward - Arndt et al. 1996)

COIeR1 GCTCGTGTRTCTACRTCCAT (reverse - Arndt et al. 1996)

Permalink Reply by Prasanna Kumar on May 28, 2011 at 3:46am

Dear Dirk

thanks for putting things in nut shell.

all primers in one page.

good to see and will be useful to me.

Permalink Reply by Gert Woerheide on May 28, 2011 at 5:55am

For sponges see primer page at

www.spongebarcoding.org

Permalink Reply by Rodolfo Barreiro on May 31, 2011 at 4:31am

Thanks a lot.

Rodolfo

Permalink Reply by Erik M. Pilgrim on June 7, 2011 at 1:04pm

Marker: COI

Taxonomic group: bivalves, gastropods, other molluscs?

This primer was developed for bivalves (hence the name 'veneroid'), but has worked on gastropods. Could work for other molluscan groups. It is used in combination with HCO2198, the standard reverse barcoding primer.

veneroidLCO YAGNACYAATCATAAAGATATTGG