international online community for dna barcoding professionals

This is a bulletin board for adding primers that are used in Marine Barcoding. Please add primer names, sequences and all relevant information you want to share in the reply field.

Views: 1988

Replies to This Discussion

Marker: COI

Taxonomic group: Crustaceans (universal)

Developed as alternative to the Folmer primer combination with a couple of degenerate sites

designed by: Dirk Steinke (2007) unpublished.



Good day, do you have the thermal profile of this? Thanks and best regards.


Marker: COI

Taxonomic group: Polychaetes

Works with a variety of polychaete groups. Unfortunately not all of them :-(

designed by: Christy M. Carr



Marker: COI

Taxonomic group: Gastropods

Was designed for cowries but works for a variety of gastropods and a few bivalves.

designed by: Chris Meyer 2003. Biological Journal of the Linnean Society. 79: 401-459.



Hi Dirk,

This is a really terrific discussion...thanks for hosting and adding to it!  Have you done any bivalve work yourself?  I'm just wondering if you found some primers that worked and others that didn't work as well...I'm starting the sequencing process tomorrow on my shellfish species.  I'm starting with the LCO and HCO primers.  I'd appreciate any ideas/referrals/suggestions you may have.

All the Best,


Marker: COI

Taxonomic group: Tunicates

Works for a number of different ascidian families.

designed by: Stefaniak et al 2009. Aquat. Invasions 4 (1), 29-44.


Tun_reverse2  AACTTGTATTTAAATTACGATC (reverse)

Actually, there is a G to be added to the end of the forward primer. This nucleotide was cut off in Stefaniak's paper when her Table was trimmed. I confirmed this with Lauren Stefaniak.

Marker: COI

Taxonomic group: universal

The classical Folmer primer

designed by: Folmer et al. 1994



Marker COI

Taxonomic group: Echinoderms

Several combinations listed here. We usually start with option (1) and move on to option (2). (3) works better with Holothurians but is a bit downstream of the standard barcoding region.


LCOech1aF1  TTTTTTCTACTAAACACAAGGATATTGG  (forward - designed by Doug Eernisse - unpublished)

HCO2198  TAAACTTCAGGGTGACCAAAAAATCA (reverse - Folmer standard)


EchinoF1  TTTCAACTAATCATAAGGACATTGG (forward - Ward et al. 2008)

HCO2198  TAAACTTCAGGGTGACCAAAAAATCA (reverse - Folmer standard)


COIeF1  ATAATGATAGGAGGRTTTGG (forward - Arndt et al. 1996)

COIeR1  GCTCGTGTRTCTACRTCCAT (reverse - Arndt et al. 1996)

Thanks for consolidating this information Dirk.  Are you using the basic CCDB thermal cycler program posted at ?

YEs we do for  most of the combinations.

Dear Dirk


thanks for putting things in nut shell.

all primers in one page.

good to see and will be useful to me.



Tory's site-wide code

New to the Connect network?

Watch our Intro Webinar

Introduce yourself to the Connect community

Write a blog post

Ask a question

Tory's code

© 2015   Created by Mike Trizna.   Powered by

Badges  |  Report an Issue  |  Terms of Service