PCR for fungi's COI region (cytochrome oxidase I)

Replies to This Discussion

Permalink Reply by Isaac Chow on January 18, 2011 at 9:05am

why would you like to get the COI amplified in fungi species, consider the co-existing of more than one species, you could probably get noise even with ITS primers

• ▶ Reply

Permalink Reply by Diego Pignataro on January 18, 2011 at 10:33am

I´m agree with Isaac. I will try this primers in my fungus sampels next week. Now we are trying to get an appropiate DNA extraction protocol (basidiomicetos) do you suggest one?

 

I will try with this:

Rapid DNA Extraction for Screening SoilFilamentous Fungi Using PCR AmplificationG. A. Płaza1*, R. Upchurch2, R. L. Brigmon3, W. B. Whitman2, K. Ulfig1

Polish Journal of Environmental Studies Vol. 13, No. 3 (2004), 315-318

 

About the primers check this out:

 

ITS8-F :  AGTCGTAACAAGGTTTCCGTAGGTG

ITS6-R  : TTCCCGCTTCACTCGCAGT

 

good luck!

 

Diego

• ▶ Reply

Permalink Reply by Diego Pignataro on January 18, 2011 at 10:33am

I´m agree with Isaac. I will try this primers in my fungus sampels next week. Now we are trying to get an appropiate DNA extraction protocol (basidiomicetos) do you suggest one?

 

I will try with this:

Rapid DNA Extraction for Screening SoilFilamentous Fungi Using PCR AmplificationG. A. Płaza1*, R. Upchurch2, R. L. Brigmon3, W. B. Whitman2, K. Ulfig1

Polish Journal of Environmental Studies Vol. 13, No. 3 (2004), 315-318

 

About the primers check this out:

 

ITS8-F :  AGTCGTAACAAGGTTTCCGTAGGTG

ITS6-R  : TTCCCGCTTCACTCGCAGT

 

good luck!

 

Diego

• ▶ Reply

Permalink Reply by Isaac Chow on January 18, 2011 at 10:39am

Hi Diego,

 

If you are concerning the ITS regions, I would suggest the ITS4/5 (White et al, 1990).

Further, have you manager to solve your matK amplification that was raised at Mar 2010? If not, I would more than happy to provide some advises

 

isaac

• ▶ Reply

Permalink Reply by Diego Pignataro on January 18, 2011 at 10:49am

Hi Isaac,

Thanks a lot for ur replay. Yes, I did..how?..well I performed an alignment with a group of peperomias and search the more conservated region (above 500bp) et voilá. BUT I do have problems with my cinchonas samples..not worked it all. Any suggestion for that? It it well known that this samples have lots of secondary compounds and polyphenols..

 

Thanks!

 

Diego

 

 

 

• ▶ Reply

Permalink Reply by Isaac Chow on January 18, 2011 at 10:54am

Hi Diego,

 

I understand that it is always easier to amplify with trnH-psbA/ rbcL universal primers and with the matK, it is not always that lucky.

 

Alignment and re-design conserved primers will be a good move, however, it will only shorter your newly generated seq.

 

My method is to do step up PCR, start with several cycles with lower annealing temperature, together adjusting your primer concentration. I often do 5+5+30. My assumption is that you will have good quality of DNA template, if you don't, try repeat the sodium acetate + ethanol purification (cheap) or simply qiagen.

 

Good luck and welcome for further discussion.

 

rgds

isaac

• ▶ Reply

Permalink Reply by Tiago Andrade on January 28, 2011 at 2:18pm

Look,
I know about the sucess of ITS, as I use ITS to amplify my fungi sames too. But, I am using cO1 as a test.  I am testing co1 according Seifert at al (2009). I still do not sequence, but by eletroforesis results, maybe the the amount of each reagent be different for each speies group.

 

• ▶ Reply

Permalink Reply by Isaac Chow on January 28, 2011 at 8:28pm

Hi Tiago,

 

I understand you may try to work out alternative solution for the fungi barcoding, but you may also notice that it is way harder for you to try other regions else apart from ITS, not only because of the major focusing on the ITS, hence more information, but also the primers (COI) that you are using may not fit your samples, remember, barcoding is a cloud work, we united and we have better understanding. I afraid that I don't have adequate knowledge on answering you the COI barcoding on fungi. But anyway, good luck.

 

isaac

• ▶ Reply

Permalink Reply by Tiago Andrade on January 29, 2011 at 1:04pm

Alright, Isaac.

 

Thank you for your suggestion.

 

Thanks for your help too, Diego.

 

Tiago

• ▶ Reply